The peculiar biochemistry of this enzyme as well as its capacity to interact with the main proteins involved in the regulation of proteostasis suggests that TG2 plays a key role in this process. Total RNA from MEF cells was extracted using Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions and then treated with Dnase I to remove contaminant DNA. Gdje gledati. TG2 on the surface of dendritic cells modulates the dendritic cell-T cell interaction. Successful fragmentation was confirmed on a 0.8% agarose gel electrophoresis by comparing to unsheared chromatin. By a computerized docking analysis, we found that cysteamine was able to interact with TG2 close to its active site, thus inhibiting the transamidating and the PDI activities (Fig EV4A). subota, 11. siječnja 2020. craxi; 12. Moreover, this interaction drives the correct orientation of cysteamine with Cys 371, forming a covalent disulphide bridge. Bettino Craxi war der erste sozialistische Ministerpräsident der seit 1946 bestehenden Italienischen Republik. Moreover, while HSF1 hyperphosphorylation was transient in TG2+/+ MEF, it persisted also during the recovery phase in TG2−/− MEF. Dezember 2020 21:00 RAI 2. Telegiornaliste TOP 51-100. Similarly, shRNA‐mediated silencing of TG2 in TG2+/+ MEF significantly reduced the induction of HSP70 by heat shock (Fig 2C). Lilli Gruner ospita in studio Marco Travaglio e Vittorio Sgarbi. Cells were lysed in a buffer containing 150 mM NaCl, 50 mM Tris–HCl pH 7.5, 2 mM EDTA, 2% NP‐40 and freshly added protease inhibitor cocktail. For ex vivo treatments, the cells were incubated with or without cysteamine (250 μM) for 18 h. In order to obtain TG2−/− mice carrying F508del mutation in CFTR, C57Bl/6 knockout mice for TG2 62 (obtained from Gerry Melino, Department of Experimental Medicine and Biochemical Sciences, University of Rome “Tor Vergata”, Rome, Italy) were crossed with 129/FVB mice heterozygous for F508del mutation (obtained from Bob Scholte, Erasmus Medical Centre Rotterdam, the Netherlands, CF coordinated action programme EU FP6 LSHM‐CT‐2005‐018932). The authors declare that they have no conflict of interest. This CFTR activity was defined as a forskolin‐induced increase in short‐circuit current (Isc) that was partially reverted by a selective CFTR inhibitor (CFTRinh172, Fig 6E), in line with previous publications 17. Here, we focused our attention on CF, showing that the ablation/inhibition of TG2 significantly ameliorated the typical CF symptoms in a double‐transgenic mouse model in which the F508del CFTR mutation was backcrossed into a TG2 null background. Name Email * Message * Popular Posts. In the absence of TG2, we also detected a marked difference in the HSF1 phosphorylation profile, largely proposed as a requirement for HSF‐driven transcription 44, even if recent evidences show that the phosphorylation status of HSF1 does not affect the subcellular localization and DNA‐binding activity of HSF1 45. Princ (2014) danas. | 23:30. Ora in diretta su Rai Due, buona serata Amici. Cells were lysed with a mild lysis buffer, and nuclei were enriched by centrifugation at 14,000 × g for 10 min. Both treatments are known to cause the accumulation of misfolded proteins and the consequent induction of HSP70 26-28. Sede legale: Viale Mazzini, 14 - 00195 Roma, | Cap. P.Iva 06382641006. Data suggest binding of autoantibodies to TGM2 in … The relative amounts of mRNA were calculated by using the comparative Ctmethod. This is "Annalisa Chirico - TG2 Post - Il Natale che verrà" by Annalisa Chirico on Vimeo, the home for high quality videos and the people who love… Recombinant His‐TG2 (0.25 μg, Zedira) was incubated either with recombinant His‐HSF1 (0.5 μg, Enzo) or with the phosphorylated His‐HSF1 recombinant protein (0.5 μg, Enzo) in reaction buffer including 50 mM Tris–HCl pH 7.5, 150 mM NaCl, 10% glycerol in presence or not of 5 mM CaCl2 for 1 h at 30°C. Sender: Rai 2; Originaltitel: TG2 Post Länge: 20 Min; TG2 Post - Rubrica informativa del TG2 Direttore Gennaro Sangiuliano. These 3D changes influence the interaction of TG2 with multiple substrates or binding partners that are essential to carry out its biological functions 7. EMPFEHLUNG. Moreover, we report that cysteamine inhibits the PDI activity of TG2, restoring the proteostasis imbalance in CF, a finding that might explain its superior activity as a therapeutic agent. Thus, systemic cysteamine treatment switches off inflammation, rescues F508del CFTR protein expression and restores its function at the PM, both in the lungs from CFTRF508del TG2+/+ mice and in F508del CFTR bronchial epithelial cells from CF patients 24. Considering that TG2 interacts with HSF1 after HS, we asked whether the enzyme, through its PDI activity, would trigger HSF1 trimerization leading to its activation. The formation of three intermolecular S‐S bonds between two cysteine residues (Cys36 and Cys103) is essential for HSF1 trimerization and DNA binding. MOSPD2 and PTPIP51 (magenta; middle) create ER – mitochondria membrane contact sites; MOSPD2 and STARD3NL (magenta; bottom) build ER – endosome membrane contact sites. Moreover, CFTRF508del/TG2−/− mice cleared P. aerguinosa more efficiently from their lungs than CFTRF508del/TG2+/+ animals (Fig 6C). Ähnliche Videos. The formation of three intermolecular S‐S bonds between two cysteine residues (Cys36 and Cys103) is essential for HSF1 trimerization and DNA binding 35. Given the fact that cysteamine can inhibit the PDI activity of TG2 in a direct fashion, by a direct molecular interaction with the enzyme and its critical cysteines, it appears that most, if not all, of the cysteamine effects on CF must be considered as “on‐target”. In agreement with this novel function of TG2, it was previously described that stressed cells lacking TG2 are defective in the clearance of ubiquitinated protein aggregates thus predisposing them to death 12, 48. 02.12.2020, 21:00 - 21:20 Uhr. 23:30 RAI 2. Beta verzija (2016) danas. A basolateral‐to‐apical chloride gradient was established by replacing NaCl with Na‐gluconate in the apical (luminal) compartment to create a driving force for CFTR‐dependent Cl− secretion. The degree of channels co‐localization was analysed by considering the Pearson's coefficient. Pannella Giacinto detto Marc o, capolista della Rosa nel pugno al Senato, non eletto. Since then, our team is also tracking officials’ notices to know the exam date, exam center name, time & date, etc. We also analysed freshly brushed nasal epithelial cells from two F508del CFTR homozygous patients who underwent a phase II clinical trial (EudraCT 2013‐001258‐82) with cysteamine bitartrate 17. Contact Form. – 19.januar 2000.) TG2 genotype was assessed by PCR using primers: 5′‐ACGAGACTAGTGAGACGTGC‐3′, following the conditions 95°C for 5 min, then 35 cycles at 94°C for 1 min + 56°C for 45 s + 72°C for 1 min and then 72°C for 5 min, as previously described 62. The authors would like to thank Dr. E Romano from the Centre of Advanced Microscopy, Department of Biology, University of Rome Tor Vergata, for her skilful assistance in the use of the facility. All authors read and edited the manuscript. Conte, il post su Facebook di fine anno: «Il 2020 è stato difficile, il 2021 sia l'anno del riscatto» CACCIA ALLA FORTUNA Million Day, i numeri vincenti di oggi giovedì 31 dicembre 2020 It remains to be determined whether yet‐to‐be‐developed specific TG2 PDI inhibitors may replace cysteamine advantageously for the treatment of CF or other diseases linked to TG2 deregulation. TG2 is a ubiquitous mammalian enzyme that catalyzes the transamidation or deamidation of its substrates. Pročitajte opis za emisiju na RAI Due - Tg2 Post. A primer set amplifying an HSP70.3 intergenic region (mHSP70.3 Intergenic Region Fwd 5′‐GTGGCGCATGCCTTTGAT‐3′; mHSP70.3 Intergenic Region Rev 5′‐CTTTGTAGAACAGGCTGACCTTGA‐3′) was used as control for the ChIP. Cysteamine also decreased protein expression of HSP40 (Fig 7D) and HSP27 (Fig EV4B), others HSF1‐regulated chaperones involved in F508del CFTR handling 42, 43. Das Kabinett Craxi I wurde nach den Parlamentswahlen vom 27.Juni 1983 am 4. EF, RM and NAB performed the experiments on CF mice. TG2+/+ MEF, grown on coverslips, were subjected to heat shock, then washed with PBS and fixed in 4% paraformaldehyde for 10 min at room temperature. Un appuntamento con l'attualità dell'ultimo minuto, gli approfondimenti, la cronaca. Featured Post Search This Blog. Anche oggi si parla di hammamet il film di gianni amelio su craxi bettino . The above‐reported findings prompted us to investigate whether the effects of TG2 on HSF1‐mediated HSP70 transactivation may contribute to CF pathogenesis in the mouse model. Una leadership politica che non può essere ridotta a un caso di cronaca giudiziaria. Based on these findings, we evaluated the hypothesis of whether TG2 might influence proteostasis by modulating the chaperone homeostasis. I primi passi a Milano nella politica, gli anni della scalata nel partito (a cui diede una nuova identità riformista e che rilanciò facendosi largo tra Democrazia Cristiana e Partito Comunista) e nel paese. Another aspect of the present study is that it clarifies and extends prior observations on the role of TG2 in degenerative disorders, such as the Huntington disease (HD), in which TG2 inhibitors such as cysteamine reversed transcriptional deregulation due to the expression of mutated huntingtin 46, 47. To characterize how TG2 could modulate HSF1 activation, we first verified whether the two proteins could interact. Interestingly, CFTRF508del TG2−/− mice exhibited a partial recovery (about 40%) of the CFTR functionality and exhibited a marked amelioration of CF symptoms, including reduced inflammatory and pulmonary inflammation as well as improved clearance of, and resistance to, Pseudomonas aeroginosa. Soc. The improvements observed in the absence of TG2 were paralleled by reduction in the HSF1 trimerization, resulting in a drastic reduction in HSP70 levels. In the last few years, it has been established that TG2 switches its 3D structure from a nucleotide‐bound “closed” to the transamidation/PDI prone “open” conformation 5, 6. Transglutaminase type 2 (TG2) is a multifunctional, ubiquitously expressed member of the TG family that catalyses post‐translational modifications of proteins through both Ca2+‐dependent and Ca2+‐independent reactions 1. 19 gennaio 2018-2000 - anniversario morte di Craxi - celebrazione a Tunisi - dal TG2 20 gennaio Thermocycling consisted of an initial polymerase activation step at 98°C for 5 min, and amplification was performed with 35 cycles of 95°C for 15 s, 68°C for 10 s and 72°C for 20 s with data acquisition at this stage and the reaction finished by the built‐in melt curve. Notably, formation of HSF1 trimers in the nasal epithelial cells from CF patients was increased with respect to normal controls; however, cysteamine treatment abolished this increase (Fig 7E and F). Caccia si, dunque, ma non come la intende “il fucilatore domenicale” (definizione di Salvatori) che sfoga la sua aggressività latente come fa il tifoso allo stadio, “il suo parente più affine”. 25.11.2020, 21:00 - 21:20 Uhr. Download PDF of article text and main figures. One of the mechanisms through which eukaryotic cells adapt to intracellular and environmental stress is the heat‐shock response. Pisa, regata storica delle antiche repubbliche marinare d'Italia : L'omonima gara va in onda in diretta a cura del TG2. CFTR channels present at the apical surface of the epithelium (lumen side of the tissue) were activated. Likewise, HSF1 and the HSPs have been shown to play a key regulatory role in dictating the fate of their abnormal client proteins versus the proteasome and/or autophagy 31. 11.12.2020, 21:00 - 21:20 Uhr. We demonstrate that transglutaminase type 2 (TG2), dependent on its protein disulphide isomerase activity, triggers the trimerization and activation of HSF1 regulating adaptation to stress and proteostasis impairment. Il problema è che in Italia siamo ostaggi della cultura del NO. Western blot analysis of HSP70 expression (upper) and HSF1 nuclear translocation (lower) in TG2, Densitometric analysis of HSP25 and BAG3 protein in TG2, Western blot analysis and densitometric analysis of HSP70 protein levels in the intestine tissue lysates of CFTR, Western blot and densitometric analysis of HSP70 and HSP40 protein levels in nasal epithelial cells, from CF patients (, Western blot analysis of HSF1 and phosphorylated HSF1 at Ser326 in nasal epithelial cells, from CF patients (, Densitometric analysis of HSF1 polymers formation and HSF1 phosphorylation in nasal epithelial cells, from CF patients, cultured, Transglutaminase 2: an enigmatic enzyme with diverse functions, Transglutaminases: crosslinking enzymes with pleiotropic functions, Cellular functions of tissue transglutaminase, TG2 transamidating activity acts as a reostat controlling the interplay between apoptosis and autophagy, “Tissue” transglutaminase contributes to the formation of disulphide bridges in proteins of mitochondrial respiratory complexes, Transglutaminase 2: a molecular swiss army knife, The transglutaminase type 2 and pyruvate kinase isoenzyme M2 interplay in autophagy regulation, Transglutaminase 2 interaction with small heat shock proteins mediate cell survival upon excitotoxic stress, Identification of DNAJA1 as a novel interacting partner and substrate of human transglutaminase 2, CHIP‐mediated degradation of transglutaminase 2 negatively regulates tumor growth and angiogenesis in renal cancer, Transglutaminase 2 is involved in autophagosome maturation, Type 2 transglutaminase is involved in the autophagy‐dependent clearance of ubiquitinated proteins, Transglutaminase 2 ablation leads to mitophagy impairment associated with a metabolic shift towards aerobic glycolysis, Transglutaminase type 2‐dependent selective recruitment of proteins into exosomes under stressful cellular conditions, Cystamine treatment is neuroprotective in the YAC128 mouse model of Huntington disease, The effect of cysteamine bitartrate on adiponectin multimerization in non‐alcoholic fatty liver disease and healthy subjects, A novel treatment of cystic fibrosis acting on‐target: cysteamine plus epigallocatechin gallate for the autophagy‐dependent rescue of class II‐mutated CFTR, Type 2 transglutaminase, mitochondria and Huntington's disease: menage a trois, Characterization of distinct sub‐cellular location of transglutaminase type II: changes in intracellular distribution in physiological and pathological states, Transglutaminase 2 inhibitors and their therapeutic role in disease states, Cystamine metabolism and brain transport properties: clinical implications for neurodegenerative diseases, Chloride channels in the apical membrane of normal and cystic fibrosis airway and intestinal epithelia, Defective CFTR induces aggresome formation and lung inflammation in cystic fibrosis through ROS‐mediated autophagy inhibition, Restoration of CFTR function in patients with cystic fibrosis carrying the F508del‐CFTR mutation, Manipulating proteostasis to repair the F508del‐CFTR defect in cystic fibrosis, Hyperphosphorylation of heat shock transcription factor 1 is correlated with transcriptional competence and slow dissociation of active factor trimers, Proteasome inhibitor MG132 induces BAG3 expression through activation of heat shock factor 1, Inhibition of inducible heat shock protein‐70 (hsp72) enhances bortezomib‐induced cell death in human bladder cancer cells, Regulation of the heat shock transcriptional response: cross talk between a family of heat shock factors, molecular chaperones, and negative regulators, Heat shock factors: integrators of cell stress, development and lifespan, Signal transduction pathways leading to heat shock transcription, Activation of human heat shock genes is accompanied by oligomerization, modification, and rapid translocation of heat shock transcription factor HSF1, Roles of the heat shock transcription factors in regulation of the heat shock response and beyond, BAG3 affects the nucleocytoplasmic shuttling of HSF1 upon heat stress, Redox regulation of mammalian heat shock factor 1 is essential for Hsp gene activation and protection from stress, Two distinct disulfide bonds formed in human heat shock transcription factor 1 act in opposition to regulate its DNA binding activity, Redox regulation of transglutaminase 2 activity, The common variant of cystic fibrosis transmembrane conductance regulator is recognized by hsp7O and degraded in a pre‐Golgi non lysosomal compartment, Living in constant crisis–when stress management becomes the problem, Modulation of the maladaptive stress response to manage diseases of protein folding, The Hdj‐2/Hsc70 chaperone pair facilitates early steps in CFTR biogenesis, Small heat shock proteins target mutant cystic fibrosis transmembrane conductance regulator for degradation via a small ubiquitin‐like modifier‐dependent pathway, mTOR is essential for the proteotoxic stress response, HSF1 activation and heat shock protein synthesis, Uncoupling stress‐inducible phosphorylation of heat shock factor 1 from its activation, Type 2 transglutaminase in Huntington's disease: a double‐edged sword with clinical potential, Inhibition of transglutaminase 2 mitigates transcriptional dysregulation in models of Huntington disease. Io e Mentana rifiutammo e ci cacciarono dal Tg2” Si tratta di quando Antonio Di Pietro, interessato dall’avv. To bind DNA and transactivate target genes, HSF1 must trimerize following the formation of disulphide bonds between cysteine residues 35, 36. Thus, TG2 can be viewed as a dynamic platform that aims at restoring cellular imbalances. Here, we provide the first evidence that the HSF1 trimerization is mediated by the PDI activity of TG2 (Fig EV5). Only one binding site, defined by His 335, Asp 358, Cys 371, Phe 392 and Glu 396, resulted to be compatible and was then selected for the docking analysis. Docking analysis of cysteamine binding to TG2. Figure 3.TG2 protein levels affect HSF1 nuclear translocation and phosphorylation. 2 / 107. For example, among the TG2 intracellular partners, many are molecular chaperones, such as the heat‐shock proteins HSP70, HSP27, HSP90 as well as co‐chaperone from the DNAjs and the BAG families 7-10. Francesca Romana Elisei, conduttrice di Tg2 Post ogni sera su Raidue, ieri esibiva un look sexy e dark. This result was also confirmed by immunofluorescence microscopy showing the co‐localization of TG2 and HSF1 in the nucleus after HS (Fig 4C and D). Aveva infatti una sua teoria, che difendeva gettando gli occhi strabuzzati oltre le lenti spesse come vetrine: «Bettino Craxi non mi fece alcun favore nominandomi direttore del Tg2. La splendida Manuela Moreno nell'edizione serale del TG2 Post in Full HD (1080p) This video is unavailable. Zašto se registrirati? 31:11. ), the Italian Ministry of University and Research (FIRB Accordi di Programma 2011), the Italian Ministry of Health (Ricerca Corrente and Ricerca Finalizzata RF2010 2305199), Fondazione Fibrosi Cistica (FFC#8/2015 to M.P., FFC#2/2016 to G.C. RAI 2 | Montag | 21:00. Indeed, the peculiar biochemistry of TG2, as well its capacity to interact with the major proteins involved in the regulation of proteostasis 18, 48 in various intracellular compartments, confers to TG2 a unique ability to act as a guardian of the proteome under stressful conditions. Upon stress, HSF1 is released from these binding partners and trimerizes, forming a complex that translocates into the nucleus where it binds to DNA and activates target genes 30, 31. Euro 242.518.100,00 interamente versato, Ufficio del Registro delle Imprese di Roma © RAI 2014 - tutti i diritti riservati. Sender: Rai 2; Originaltitel: TG2 Post Länge: 20 Min; TG2 Post - Rubrica informativa del TG2 Direttore Gennaro Sangiuliano. Subsequently, we analysed the sensitivity of these mice to the infection with Pseudomonas aeruginosa, a persistent bacteria that commonly infects and kills CF patients as a result of chronic lung inflammation. M5sParlamento 608 views New 25:27 Danilo Toninelli (M5S) a L'aria che Tira 5/5/2020 - … TG2+/+ and TG2−/− MEFs (murine embryonic fibroblasts) were obtained by spontaneous immortalization of fibroblasts derived from C57BL/6 mice embryos either wild type or knockout for TG2. Introduction. Importantly, the regulation of HSF1‐HSP70 pathway by TG2 occurs through its PDI activity and not the transamidating one. Chamber solution was buffered by bubbling with a mixture of 95% O2 and 5% CO2. Sender: Rai 2; Originaltitel: TG2 Post Länge: 20 Min; TG2 Post - Rubrica informativa del TG2 Direttore Gennaro Sangiuliano. Intestinal HSP70 expression was increased in CFTRF508del/TG2+/+ mice over WT (CFTRwt/TG2+/+) controls, and this HSP70 overexpression was reduced in CFTRF508del/TG2−/− mice (Fig 7A). By combining in vivo approaches in transgenic mice with in vitro studies, we demonstrate that TG2, by acting as a PDI, is able to activate HSF1, the master transcriptional regulator of the stress‐responsive genes. In addition, recent findings show that HSF1 is also able to regulate gene transcription for the maintenance of proteostasis capacity in unstressed conditions 61. A median filter was applied to the images to reduce the background noise before threshold analysis. Tel: +39 0672 594234; E‐mail: [email protected]. Nuclear and cytosolic extracts were obtained using the NE‐PER Nuclear and Cytoplasmic Extraction Kit (Thermo Scientific). We show that the inhibition of TG2 restores the unbalance in HSF1‐HSP70 pathway in cystic fibrosis (CF), a human disorder characterized by deregulation of proteostasis. Durata: 00:25:49; Andato in onda: 30/12/2020; Visualizzazioni: Commenta; Mail to; Preferiti; Correlati; Sito. 713) and were carried out in strict respect of European and National regulations. First, mice that were either wild type or knockout for TG2 (TG2+/+ and TG2−/− mice) were exposed to hyperthermic stress at 42°C for 20 min to stimulate heat‐shock response and HSP70 induction. Blots were blocked in 5% non‐fat dry milk in T‐PBS (PBS + 0.05% Tween‐20) for 1 h at room temperature and then incubated overnight with the described antibodies. However, so far the mechanism by which Cys36 and Cys103 form this intermolecular S‐S bond was elusive. FR designed and performed most of the experiments. In order to define the molecular mechanism regulating the TG2‐dependent induction of HSP70, we focused our attention on the heat‐shock factor 1 (HSF1), the main transcription factor involved in HSP70 expression. Andrea Barbato helyét ebben az évben Ugo Zatterin vette át. Un’ascesa irresistibile nel partito e nella sinistra sottratta all’egemonia comunista. Vi ripropongo il bel dibattito di ieri sera a #Tg2Post. Figure 4.TG2 interacts with HSF1 in the nuclear compartment of cells exposed to heat shock. The protein disulphide activity of TG2 post‐translationally modifies HSF1. TG2−/− MEFTG2 stably reconstituted with the unmutated TG2 was obtained as previously described 4. In this regard, in the last years it has become clear that HSF1 is able to regulate not only cytosolic but also ER and mitochondria proteins 57-60, suggesting a possible interplay between HSF1 activation and ERAD pathway, involved in CFTR degradation. To this aim, mice were infected by intratracheal instillation of the P. aeruginosa PAO1 strain and either sacrificed 1 day later, to surgically collect the lungs and measure bacterial clearance, or kept in an isolator to monitor their survival. Here, we show that the PDI activity of TG2 catalyses HSF1 trimerization and its absence/inhibition impairs translocation of the HSF1 trimeric complex in the nucleus. Giorgia Meloni: Ora a Tg2 Post su Rai 2, mi seguite? TG2, by activating HSF1, regulates HSP70 protein expression. LF performed the immunofluorescence analysis. HSF1 polymerized only if it was phosphorylated and in the absence of calcium, which is known to interfere with the redox‐sensitive cysteines of TG2 and consequently with its PDI activity 37. Sendetermine. Short‐circuit current and resistance were acquired or calculated using the VCC‐600 transepithelial clamp from Physiologic Instruments and the Acquire &Analyze2∙3 software for data acquisition (Physiologic Instruments), as previously described 17. To assess the presence of F508del mutation, DNA was digested with SspI restriction enzyme (Thermo Scientific) at 37°C and PCR was carried out with primers: 5′‐CACAACACTGACACAAGTAGC‐3′, following the conditions 95°C for 5 min, then 33 cycles at 95°C for 1 min + 52°C for 1 min + 72°C for 1 min and then 72°C for 7 min. Recently, it has been demonstrated that the administration of the TG2 inhibitor cysteamine restores CFTR function both in CF mice and patients bearing misfolded CFTR mutant proteins either in homozygous or in compound heterozygous form 17, 23, 24. … 16.11.2020, 21:00 - 21:20 Uhr. Actin primers: 5′‐GGCTGTATTCCCCTCCATCG‐3′, 5′‐CCAGTTGGTAACAATGCCATGT‐3′. LDS Sample Buffer 4× (Life Technologies) containing 2.86 M 2‐mercaptoethanol (Sigma‐Aldrich) was added to beads, and samples were boiled at 95°C for 10 min.

Dario Acocella Figlia, Tenaglie Nome Sovrabbondante, Poesia Per I Genitori, Brunello Di Montalcino Annate Migliori, Tema L'amicizia Ai Tempi Dei Social Network, Una Mattina Einaudi Pdf,